Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGACCTTGGATGCCAAGGCCAGCAG[G/C]GCAGAAAGACGCATGCCTGGAGGTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 600339 MIM: 611836 | ||||||||||||||||||||
Literature Links: |
HDGF PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HDGF - hepatoma-derived growth factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPL24 - mitochondrial ribosomal protein L24 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024540.3 | 265 | Silent Mutation | GCC,GCG | A,A 5 | NP_078816.2 | |
NM_145729.2 | 265 | Silent Mutation | GCC,GCG | A,A 5 | NP_663781.1 | |
XM_011509981.2 | 265 | Silent Mutation | GCC,GCG | A,A 5 | XP_011508283.1 | |
XM_011509982.2 | 265 | Silent Mutation | GCC,GCG | A,A 5 | XP_011508284.1 |
RRNAD1 - ribosomal RNA adenine dimethylase domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |