Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGACTTGGAATCAGCCATTCCTCCA[A/G]AAGCCCTGGCTCCTTGTTTTTAAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607993 | ||||||||||||||||||||
Literature Links: |
ARMC6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARMC6 - armadillo repeat containing 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199196.1 | Intron | NP_001186125.1 | ||||
NM_033415.3 | Intron | NP_219483.1 | ||||
XM_005260157.3 | Intron | XP_005260214.1 | ||||
XM_017027484.1 | Intron | XP_016882973.1 | ||||
XM_017027485.1 | Intron | XP_016882974.1 |
SUGP2 - SURP and G-patch domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |