Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTACTGCTGAAGAAACTCCAGCTCA[G/T]GTATGGGAGTAGCCAGGATGGGATC
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 126660 MIM: 600869 | ||||||||||||||||||||||||||||||||
Literature Links: |
DBN1 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
|||
AFR - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
DBN1 - drebrin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GRK6 - G protein-coupled receptor kinase 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRR7 - proline rich 7 (synaptic) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001174101.1 | 1360 | Intron | NP_001167572.1 | |||
NM_001174102.1 | 1360 | Intron | NP_001167573.1 | |||
NM_030567.4 | 1360 | Intron | NP_085044.2 | |||
XM_011534662.1 | 1360 | UTR 5 | XP_011532964.1 | |||
XM_011534663.2 | 1360 | Intron | XP_011532965.1 | |||
XM_017009896.1 | 1360 | UTR 5 | XP_016865385.1 | |||
XM_017009897.1 | 1360 | Intron | XP_016865386.1 |
PRR7-AS1 - PRR7 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |