Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGCAGCGTGTGATCAAACTGCACC[A/G]CGGGCGAGGGGTGGCTGCCATGCAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||
Literature Links: |
DCUN1D2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DCUN1D2 - defective in cullin neddylation 1 domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMCO3 - transmembrane and coiled-coil domains 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017905.4 | 471 | Missense Mutation | CAC,CGC | H,R 37 | NP_060375.4 | |
XM_006719969.1 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_006720032.1 | |
XM_011537498.2 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_011535800.1 | |
XM_011537501.2 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_011535803.1 | |
XM_011537502.2 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_011535804.1 | |
XM_011537504.2 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_011535806.1 | |
XM_011537506.2 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_011535808.1 | |
XM_011537507.2 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_011535809.1 | |
XM_011537509.2 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_011535811.1 | |
XM_017020629.1 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_016876118.1 | |
XM_017020630.1 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_016876119.1 | |
XM_017020631.1 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_016876120.1 | |
XM_017020632.1 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_016876121.1 | |
XM_017020633.1 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_016876122.1 | |
XM_017020634.1 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_016876123.1 | |
XM_017020635.1 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_016876124.1 | |
XM_017020636.1 | 471 | Missense Mutation | CAC,CGC | H,R 37 | XP_016876125.1 |