Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGTGTCGGCGCCGGGCCCGGCCTC[A/C]GGGAGCGGGAAGCGGTCGATGGACA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 143023 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LMNTD2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LMNTD2 - lamin tail domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_173573.2 | 1617 | Silent Mutation | CCG,CCT | P,P 491 | NP_775844.2 | |
XM_011519965.2 | 1617 | Silent Mutation | CCG,CCT | P,P 564 | XP_011518267.2 | |
XM_011519967.2 | 1617 | Silent Mutation | CCG,CCT | P,P 524 | XP_011518269.2 | |
XM_017017476.1 | 1617 | Missense Mutation | CGG,CTG | R,L 586 | XP_016872965.1 | |
XM_017017477.1 | 1617 | Missense Mutation | CGG,CTG | R,L 581 | XP_016872966.1 | |
XM_017017478.1 | 1617 | Missense Mutation | CGG,CTG | R,L 518 | XP_016872967.1 | |
XM_017017479.1 | 1617 | Silent Mutation | CCG,CCT | P,P 564 | XP_016872968.1 |
LRRC56 - leucine rich repeat containing 56 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_198075.3 | 1617 | Intron | NP_932341.1 | |||
XM_005252775.2 | 1617 | Intron | XP_005252832.1 | |||
XM_005252776.2 | 1617 | Intron | XP_005252833.1 | |||
XM_006718132.2 | 1617 | Intron | XP_006718195.1 | |||
XM_006718133.2 | 1617 | Intron | XP_006718196.1 | |||
XM_011519875.2 | 1617 | Intron | XP_011518177.1 | |||
XM_011519876.1 | 1617 | Intron | XP_011518178.1 | |||
XM_011519877.2 | 1617 | Intron | XP_011518179.1 | |||
XM_017017167.1 | 1617 | Intron | XP_016872656.1 | |||
XM_017017168.1 | 1617 | Intron | XP_016872657.1 |
MIR210HG - MIR210 host gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RASSF7 - Ras association domain family member 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |