Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAGGACGGAGAGCGCTTCTCATTC[G/T]AGGATTCGGACCGTTTTGAGGAGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608842 MIM: 616932 | ||||||||||||||||||||
Literature Links: |
CHCHD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CHCHD1 - coiled-coil-helix-coiled-coil-helix domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FUT11 - fucosyltransferase 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZSWIM8 - zinc finger SWIM-type containing 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001242487.1 | 351 | Nonsense Mutation | GAG,TAG | E,* 17 | NP_001229416.1 | |
NM_001242488.1 | 351 | Nonsense Mutation | GAG,TAG | E,* 17 | NP_001229417.1 | |
NM_015037.3 | 351 | Nonsense Mutation | GAG,TAG | E,* 17 | NP_055852.2 | |
XM_005269648.2 | 351 | Nonsense Mutation | GAG,TAG | E,* 17 | XP_005269705.1 | |
XM_005269653.3 | 351 | Nonsense Mutation | GAG,TAG | E,* 17 | XP_005269710.1 | |
XM_005269655.3 | 351 | Nonsense Mutation | GAG,TAG | E,* 17 | XP_005269712.1 | |
XM_006717725.3 | 351 | Nonsense Mutation | GAG,TAG | E,* 17 | XP_006717788.1 | |
XM_011539544.1 | 351 | Nonsense Mutation | GAG,TAG | E,* 17 | XP_011537846.1 | |
XM_017015978.1 | 351 | Nonsense Mutation | GAG,TAG | E,* 17 | XP_016871467.1 |