Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGGCGCTTGAAAGCTTCCAGGTCC[C/T]GGTGGGTGCCCATGATCAGCCGGCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612746 MIM: 608229 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C19orf57 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C19orf57 - chromosome 19 open reading frame 57 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024323.3 | 2099 | Missense Mutation | CAG,CGG | Q,R 596 | NP_077299.3 | |
XM_006722885.3 | 2099 | Missense Mutation | CAG,CGG | Q,R 735 | XP_006722948.2 | |
XM_011528286.2 | 2099 | Intron | XP_011526588.1 | |||
XM_011528287.2 | 2099 | Intron | XP_011526589.1 | |||
XM_017027300.1 | 2099 | Missense Mutation | CAG,CGG | Q,R 509 | XP_016882789.1 | |
XM_017027301.1 | 2099 | Missense Mutation | CAG,CGG | Q,R 478 | XP_016882790.1 |
MIR181C - microRNA 181c | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR181D - microRNA 181d | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NANOS3 - nanos C2HC-type zinc finger 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |