Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGATGTTCCTATCCAAATCCACAG[C/T]AAGCTGGTGTTGCAATTTTCCAGAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||
Literature Links: |
NXPE2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
NXPE2 - neurexophilin and PC-esterase domain family member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_182495.5 | 867 | Intron | NP_872301.2 | |||
XM_011542604.2 | 867 | Intron | XP_011540906.1 | |||
XM_017017206.1 | 867 | Intron | XP_016872695.1 | |||
XM_017017207.1 | 867 | Intron | XP_016872696.1 | |||
XM_017017208.1 | 867 | Intron | XP_016872697.1 | |||
XM_017017209.1 | 867 | Intron | XP_016872698.1 | |||
XM_017017210.1 | 867 | Intron | XP_016872699.1 | |||
XM_017017211.1 | 867 | Intron | XP_016872700.1 | |||
XM_017017212.1 | 867 | Intron | XP_016872701.1 |
NXPE4 - neurexophilin and PC-esterase domain family member 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001077639.1 | 867 | Missense Mutation | ACT,GCT | T,A 384 | NP_001071107.1 | |
NM_017678.2 | 867 | Missense Mutation | ACT,GCT | T,A 100 | NP_060148.2 | |
XM_006718865.3 | 867 | Intron | XP_006718928.1 | |||
XM_011542881.2 | 867 | Missense Mutation | ACT,GCT | T,A 384 | XP_011541183.1 | |
XM_011542882.2 | 867 | Missense Mutation | ACT,GCT | T,A 315 | XP_011541184.1 | |
XM_011542883.2 | 867 | Intron | XP_011541185.1 |