Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCTACAGATGAGAGTGGCAATGGG[C/T]TTCCCAAAACCAAAGAGGCAGCCCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608842 MIM: 603268 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CHCHD1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CHCHD1 - coiled-coil-helix-coiled-coil-helix domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDST2 - N-deacetylase and N-sulfotransferase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZSWIM8 - zinc finger SWIM-type containing 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001242487.1 | 2436 | Missense Mutation | CTT,TTT | L,F 712 | NP_001229416.1 | |
NM_001242488.1 | 2436 | Missense Mutation | CTT,TTT | L,F 712 | NP_001229417.1 | |
NM_015037.3 | 2436 | Missense Mutation | CTT,TTT | L,F 712 | NP_055852.2 | |
XM_005269648.2 | 2436 | Missense Mutation | CTT,TTT | L,F 712 | XP_005269705.1 | |
XM_005269653.3 | 2436 | Missense Mutation | CTT,TTT | L,F 712 | XP_005269710.1 | |
XM_005269655.3 | 2436 | Missense Mutation | CTT,TTT | L,F 678 | XP_005269712.1 | |
XM_006717725.3 | 2436 | Missense Mutation | CTT,TTT | L,F 712 | XP_006717788.1 | |
XM_011539544.1 | 2436 | Missense Mutation | CTT,TTT | L,F 712 | XP_011537846.1 | |
XM_017015978.1 | 2436 | Missense Mutation | CTT,TTT | L,F 712 | XP_016871467.1 |
ZSWIM8-AS1 - ZSWIM8 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |