Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCCGGGCGCGCCACACAACAGCAC[A/G]CACACGCGTCCGCCGGGGGCGTCGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602649 MIM: 602756 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C19orf24 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C19orf24 - chromosome 19 open reading frame 24 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017914.3 | 203 | Silent Mutation | ACA,ACG | T,T 58 | NP_060384.3 |
CIRBP - cold inducible RNA binding protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001280.2 | 203 | Intron | NP_001271.1 | |||
NM_001300815.1 | 203 | Intron | NP_001287744.1 | |||
NM_001300829.1 | 203 | Intron | NP_001287758.1 | |||
XM_006722637.1 | 203 | Intron | XP_006722700.1 | |||
XM_011527668.1 | 203 | Intron | XP_011525970.1 | |||
XM_017026237.1 | 203 | Intron | XP_016881726.1 |
CIRBP-AS1 - CIRBP antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EFNA2 - ephrin A2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |