Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGCTTCTTATAGTCAGTGGAAACT[A/G]CAAGGAACTAAGAGGAGAGGGAAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604637 MIM: 138450 MIM: 615521 | ||||||||||||||||||||
Literature Links: |
NDUFA4L2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NDUFA4L2 - NDUFA4, mitochondrial complex associated like 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020142.3 | 1094 | Missense Mutation | NP_064527.1 | |||
XM_005269033.2 | 1094 | Missense Mutation | XP_005269090.1 | |||
XM_011538573.2 | 1094 | Missense Mutation | XP_011536875.1 |
NXPH4 - neurexophilin 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SHMT2 - serine hydroxymethyltransferase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001166356.1 | 1094 | Intron | NP_001159828.1 | |||
NM_001166357.1 | 1094 | Intron | NP_001159829.1 | |||
NM_001166358.1 | 1094 | Intron | NP_001159830.1 | |||
NM_001166359.1 | 1094 | Intron | NP_001159831.1 | |||
NM_005412.5 | 1094 | Intron | NP_005403.2 | |||
XM_011538675.2 | 1094 | Intron | XP_011536977.1 | |||
XM_011538676.2 | 1094 | Intron | XP_011536978.1 | |||
XM_011538677.2 | 1094 | Intron | XP_011536979.1 | |||
XM_011538678.2 | 1094 | Intron | XP_011536980.1 |
STAC3 - SH3 and cysteine rich domain 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |