Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCATTCAAGATAGTCCCTTTGGAG[A/T]TGCGCCCCTGGGTCGAAGCCACTAC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610695 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
HSPB6 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
HSPB6 - heat shock protein family B (small) member 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LIN37 - lin-37 DREAM MuvB core complex component | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PROSER3 - proline and serine rich 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039887.2 | 123 | Missense Mutation | GAT,GTT | D,V 17 | NP_001034976.2 | |
XM_011526528.1 | 123 | Missense Mutation | GAT,GTT | D,V 17 | XP_011524830.1 | |
XM_011526529.2 | 123 | Missense Mutation | GAT,GTT | D,V 17 | XP_011524831.1 | |
XM_011526530.1 | 123 | Missense Mutation | GAT,GTT | D,V 17 | XP_011524832.1 | |
XM_011526531.1 | 123 | Missense Mutation | GAT,GTT | D,V 17 | XP_011524833.1 | |
XM_011526532.1 | 123 | Missense Mutation | GAT,GTT | D,V 17 | XP_011524834.1 | |
XM_011526533.2 | 123 | Missense Mutation | GAT,GTT | D,V 17 | XP_011524835.1 | |
XM_011526534.1 | 123 | Missense Mutation | GAT,GTT | D,V 17 | XP_011524836.1 | |
XM_011526535.2 | 123 | Intron | XP_011524837.1 | |||
XM_011526536.2 | 123 | Missense Mutation | GAT,GTT | D,V 17 | XP_011524838.1 |