Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTACCTCTCCAATGTACTTACCTGT[C/T]CTTGGGATGATGACAATGAAGCGGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
10 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 112260 MIM: 614579 MIM: 610962 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BGLAP PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BGLAP - bone gamma-carboxyglutamate protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PAQR6 - progestin and adipoQ receptor family member 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PMF1-BGLAP - PMF1-BGLAP readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMG5 - SMG5, nonsense mediated mRNA decay factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001323614.1 | 2753 | Silent Mutation | AGA,AGG | R,R 833 | NP_001310543.1 | |
NM_001323615.1 | 2753 | Silent Mutation | AGA,AGG | R,R 840 | NP_001310544.1 | |
NM_001323616.1 | 2753 | Silent Mutation | AGA,AGG | R,R 820 | NP_001310545.1 | |
NM_001323617.1 | 2753 | Silent Mutation | AGA,AGG | R,R 820 | NP_001310546.1 | |
NM_015327.2 | 2753 | Silent Mutation | AGA,AGG | R,R 886 | NP_056142.2 | |
XM_017000842.1 | 2753 | Silent Mutation | AGA,AGG | R,R 674 | XP_016856331.1 | |
XM_017000843.1 | 2753 | Silent Mutation | AGA,AGG | R,R 625 | XP_016856332.1 |