Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAAAAGAAGAAAAAGAAACACAAA[A/G]CAAAGAAAAAGAAGAATAAGAAAAC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611643 MIM: 616474 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
NKAPL PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
NKAPL - NFKB activating protein like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001007531.2 | 781 | Missense Mutation | ACA,GCA | T,A 236 | NP_001007532.1 |
ZKSCAN4 - zinc finger with KRAB and SCAN domains 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001304506.1 | 781 | Intron | NP_001291435.1 | |||
NM_019110.4 | 781 | Intron | NP_061983.2 | |||
XM_005249095.3 | 781 | Intron | XP_005249152.1 | |||
XM_005249097.3 | 781 | Intron | XP_005249154.1 | |||
XM_005249098.3 | 781 | Intron | XP_005249155.1 | |||
XM_005249100.4 | 781 | Intron | XP_005249157.2 | |||
XM_006715095.3 | 781 | Intron | XP_006715158.1 | |||
XM_011514588.2 | 781 | Intron | XP_011512890.1 | |||
XM_011514589.2 | 781 | Intron | XP_011512891.1 | |||
XM_017010844.1 | 781 | Intron | XP_016866333.1 |
ZSCAN26 - zinc finger and SCAN domain containing 26 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |