Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGCGGCGCGGGAGTAAGTTCATCA[A/T]ATGGGACGAGGTAAGCGCGCGGGCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 186946 MIM: 600230 MIM: 601140 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FKBP2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FKBP2 - FK506 binding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105369340 - uncharacterized LOC105369340 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PLCB3 - phospholipase C beta 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000932.2 | 216 | Missense Mutation | AAA,ATA | K,I 30 | NP_000923.1 | |
NM_001184883.1 | 216 | Missense Mutation | AAA,ATA | K,I 30 | NP_001171812.1 | |
NM_001316314.1 | 216 | Missense Mutation | AAA,ATA | K,I 30 | NP_001303243.1 | |
XM_011545101.2 | 216 | Missense Mutation | AAA,ATA | K,I 30 | XP_011543403.1 | |
XM_017017925.1 | 216 | Missense Mutation | AAA,ATA | K,I 30 | XP_016873414.1 |
PPP1R14B - protein phosphatase 1 regulatory inhibitor subunit 14B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |