Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGTGACTGGGGAAGAGAGTATGC[C/T]AAGGCAGGATGAAGAGGGGAAGCTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610962 MIM: 615531 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
GLMP PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
GLMP - glycosylated lysosomal membrane protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256604.1 | 630 | Intron | NP_001243533.1 | |||
NM_001256605.1 | 630 | Silent Mutation | TTA,TTG | L,L 223 | NP_001243534.1 | |
NM_001256608.1 | 630 | Intron | NP_001243537.1 | |||
NM_001256609.1 | 630 | Silent Mutation | TTA,TTG | L,L 228 | NP_001243538.1 | |
NM_144580.2 | 630 | Silent Mutation | TTA,TTG | L,L 309 | NP_653181.1 | |
XM_011509117.2 | 630 | Silent Mutation | TTA,TTG | L,L 132 | XP_011507419.1 | |
XM_017000149.1 | 630 | Intron | XP_016855638.1 |
SMG5 - SMG5, nonsense mediated mRNA decay factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM79 - transmembrane protein 79 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VHLL - von Hippel-Lindau tumor suppressor like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |