Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATCCAGGCTGGCATGGCGGCGCAG[A/G]CGGGTGAGGAACTGCAGAACGGTAC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603150 MIM: 602216 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATP5D PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ATP5D - ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CBARP - CACN beta subunit associated regulatory protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152769.2 | 1557 | Silent Mutation | CGC,CGT | R,R 293 | NP_689982.3 | |
XM_017026555.1 | 1557 | Silent Mutation | CGC,CGT | R,R 415 | XP_016882044.1 | |
XM_017026556.1 | 1557 | Silent Mutation | CGC,CGT | R,R 293 | XP_016882045.1 | |
XM_017026557.1 | 1557 | Silent Mutation | CGC,CGT | R,R 115 | XP_016882046.1 | |
XM_017026558.1 | 1557 | Silent Mutation | CGC,CGT | R,R 115 | XP_016882047.1 | |
XM_017026559.1 | 1557 | Silent Mutation | CGC,CGT | R,R 415 | XP_016882048.1 | |
XM_017026560.1 | 1557 | Intron | XP_016882049.1 | |||
XM_017026561.1 | 1557 | Intron | XP_016882050.1 | |||
XM_017026562.1 | 1557 | Intron | XP_016882051.1 |
STK11 - serine/threonine kinase 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |