Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCCTGCCCCTGACCTTGTACTTT[C/T]GGAAGGCCGTCTGGATGACTCGGGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611508 MIM: 610056 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CAMTA2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CAMTA2 - calmodulin binding transcription activator 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001171166.1 | 3963 | Missense Mutation | CAA,CGA | Q,R 1062 | NP_001164637.1 | |
NM_001171167.1 | 3963 | Missense Mutation | CAA,CGA | Q,R 1083 | NP_001164638.1 | |
NM_001171168.1 | 3963 | Missense Mutation | CAA,CGA | Q,R 1059 | NP_001164639.1 | |
NM_015099.3 | 3963 | Missense Mutation | CAA,CGA | Q,R 1060 | NP_055914.2 | |
XM_006721478.3 | 3963 | Missense Mutation | CAA,CGA | Q,R 1065 | XP_006721541.1 | |
XM_006721481.3 | 3963 | Missense Mutation | CAA,CGA | Q,R 1036 | XP_006721544.1 | |
XM_006721482.3 | 3963 | Missense Mutation | CAA,CGA | Q,R 873 | XP_006721545.1 | |
XM_011523746.2 | 3963 | Missense Mutation | CAA,CGA | Q,R 1088 | XP_011522048.1 | |
XM_011523747.2 | 3963 | Missense Mutation | CAA,CGA | Q,R 1083 | XP_011522049.1 | |
XM_011523748.2 | 3963 | Missense Mutation | CAA,CGA | Q,R 1088 | XP_011522050.1 | |
XM_011523749.2 | 3963 | Missense Mutation | CAA,CGA | Q,R 1083 | XP_011522051.1 |
MIR6864 - microRNA 6864 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6865 - microRNA 6865 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPAG7 - sperm associated antigen 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |