Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGTGCCCATGGGGCTTCCCAGCAG[C/T]CCGGCCAGCACACTGCCCAGCCCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611290 | ||||||||||||||||||||
Literature Links: |
CNPPD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CNPPD1 - cyclin Pas1/PHO80 domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NHEJ1 - non-homologous end joining factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC23A3 - solute carrier family 23 member 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001144889.1 | 1212 | Silent Mutation | GGA,GGG | G,G 367 | NP_001138361.1 | |
NM_001144890.1 | 1212 | Silent Mutation | GGA,GGG | G,G 375 | NP_001138362.1 | |
NM_144712.4 | 1212 | Intron | NP_653313.3 |