Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGACCTGGAGGACGTAGACGGGCAG[G/T]TCCACAGTGAGGAAGGGGAGGAAGG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 615746 | |||||||||||||||||||||||
Literature Links: |
CFAP100 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CFAP100 - cilia and flagella associated protein 100 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105374089 - uncharacterized LOC105374089 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZXDC - ZXD family zinc finger C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040653.3 | 2268 | Intron | NP_001035743.1 | |||
NM_025112.4 | 2268 | Missense Mutation | GAA,GAC | E,D 823 | NP_079388.3 | |
XM_005247757.3 | 2268 | Intron | XP_005247814.1 | |||
XM_006713741.2 | 2268 | Missense Mutation | GAA,GAC | E,D 734 | XP_006713804.1 | |
XM_011513119.2 | 2268 | Missense Mutation | GAA,GAC | E,D 766 | XP_011511421.1 |