Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGCCCGTCTCATCTGCCACATTCC[A/G]CTGTATGAGACACTGCGTGGGGTCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606075 MIM: 611848 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C10orf2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C10orf2 - chromosome 10 open reading frame 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR608 - microRNA 608 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPL43 - mitochondrial ribosomal protein L43 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001308396.1 | 794 | Intron | NP_001295325.1 | |||
NM_032112.2 | 794 | Intron | NP_115488.2 | |||
NM_176792.2 | 794 | UTR 3 | NP_789762.1 | |||
NM_176793.1 | 794 | Intron | NP_789763.1 | |||
NM_176794.1 | 794 | Intron | NP_789764.1 | |||
XM_005270231.2 | 794 | Intron | XP_005270288.1 | |||
XM_006718035.3 | 794 | Intron | XP_006718098.1 | |||
XM_017016790.1 | 794 | Intron | XP_016872279.1 |
SEMA4G - semaphorin 4G | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001203244.1 | 794 | Silent Mutation | CCA,CCG | P,P 297 | NP_001190173.1 | |
NM_017893.3 | 794 | Silent Mutation | CCA,CCG | P,P 297 | NP_060363.2 | |
XM_005270008.2 | 794 | Silent Mutation | CCA,CCG | P,P 297 | XP_005270065.1 |