Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTTTTCTTCTGTCCTTTCTTCTTC[A/G]TTTTAAGGAGAACAGCTTTTTCTCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
6 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 601848 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
RBM34 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
RBM34 - RNA binding motif protein 34 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001161533.1 | 1565 | Intron | NP_001155005.1 | |||
NM_015014.2 | 1565 | Missense Mutation | ACG,ATG | T,M 412 | NP_055829.2 | |
XM_011544133.1 | 1565 | Missense Mutation | ACG,ATG | T,M 392 | XP_011542435.1 | |
XM_017000721.1 | 1565 | Missense Mutation | ACG,ATG | T,M 411 | XP_016856210.1 |
SNORA14B - small nucleolar RNA, H/ACA box 14B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TOMM20 - translocase of outer mitochondrial membrane 20 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |