Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCGCCCCCCGCAGCCCCCGTCTAC[C/T]CCCGCAGCCCCCGTCTCCCCGCTCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 151750 | ||||||||||||||||||||
Literature Links: |
LIPE PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LIPE - lipase E, hormone sensitive type | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005357.3 | 2343 | Silent Mutation | GGA,GGG | G,G 1067 | NP_005348.2 | |
XM_005258937.3 | 2343 | Silent Mutation | GGA,GGG | G,G 991 | XP_005258994.1 | |
XM_005258938.4 | 2343 | Silent Mutation | GGA,GGG | G,G 812 | XP_005258995.1 | |
XM_005258939.3 | 2343 | Silent Mutation | GGA,GGG | G,G 829 | XP_005258996.2 | |
XM_005258940.3 | 2343 | Silent Mutation | GGA,GGG | G,G 766 | XP_005258997.1 | |
XM_006723218.2 | 2343 | Silent Mutation | GGA,GGG | G,G 766 | XP_006723281.1 | |
XM_017026810.1 | 2343 | Silent Mutation | GGA,GGG | G,G 766 | XP_016882299.1 |
LIPE-AS1 - LIPE antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101930071 - uncharacterized LOC101930071 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |