Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGCCGACGGGGCCGAGCAGAGGAG[C/T]AGGCTCCCGGGCGCCTCCCGACACA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 613302 MIM: 615167 MIM: 610929 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ALKBH4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ALKBH4 - alkB homolog 4, lysine demethylase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017621.3 | 641 | Silent Mutation | CTA,CTG | L,L 201 | NP_060091.1 | |
XM_005250464.2 | 641 | Silent Mutation | CTA,CTG | L,L 128 | XP_005250521.1 | |
XM_005250465.2 | 641 | Silent Mutation | CTA,CTG | L,L 63 | XP_005250522.1 |
LRWD1 - leucine rich repeats and WD repeat domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR5090 - microRNA 5090 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ORAI2 - ORAI calcium release-activated calcium modulator 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001126340.2 | 641 | Intron | NP_001119812.1 | |||
NM_001271818.1 | 641 | Intron | NP_001258747.1 | |||
NM_001271819.1 | 641 | Intron | NP_001258748.1 | |||
NM_032831.3 | 641 | Intron | NP_116220.1 |