Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACTCTGCCAGTCCCCCTAGACACC[A/C]CTCCTCTTCTCTGCCCTCTCTCCTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
12 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 112260 MIM: 614579 MIM: 609176 MIM: 610962 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BGLAP PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BGLAP - bone gamma-carboxyglutamate protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_199173.5 | 1421 | Intron | NP_954642.1 |
PMF1 - polyamine-modulated factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PMF1-BGLAP - PMF1-BGLAP readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199661.1 | 1421 | Intron | NP_001186590.1 | |||
NM_001199662.1 | 1421 | Intron | NP_001186591.1 | |||
NM_001199663.1 | 1421 | Intron | NP_001186592.1 | |||
NM_001199664.1 | 1421 | Intron | NP_001186593.1 |
SMG5 - SMG5, nonsense mediated mRNA decay factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |