Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTAGGCTGTAGGCAGCTTGGATAAC[A/G]CCAGCATCCTGGAAAGAGCCTGGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 154580 MIM: 608844 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MAN2C1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MAN2C1 - mannosidase alpha class 2C member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256494.1 | 2878 | Silent Mutation | GGC,GGT | G,G 936 | NP_001243423.1 | |
NM_001256495.1 | 2878 | Intron | NP_001243424.1 | |||
NM_001256496.1 | 2878 | Silent Mutation | GGC,GGT | G,G 820 | NP_001243425.1 | |
NM_006715.3 | 2878 | Silent Mutation | GGC,GGT | G,G 919 | NP_006706.2 | |
XM_005254384.2 | 2878 | Silent Mutation | GGC,GGT | G,G 927 | XP_005254441.1 | |
XM_017022186.1 | 2878 | Silent Mutation | GGC,GGT | G,G 942 | XP_016877675.1 | |
XM_017022187.1 | 2878 | Intron | XP_016877676.1 | |||
XM_017022188.1 | 2878 | Intron | XP_016877677.1 |
MIR631 - microRNA 631 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NEIL1 - nei like DNA glycosylase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |