Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGGAGGTCGCTCTCCAGGCTGTG[C/T]CCGATGAGGATGGTGTCAGCGCTGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605866 MIM: 615201 MIM: 609614 | ||||||||||||||||||||
Literature Links: |
ATP8B3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATP8B3 - ATPase phospholipid transporting 8B3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100288123 - uncharacterized LOC100288123 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR1909 - microRNA 1909 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
REXO1 - RNA exonuclease 1 homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020695.3 | 3553 | Silent Mutation | GGA,GGG | G,G 1141 | NP_065746.3 | |
XM_011528144.1 | 3553 | Silent Mutation | GGA,GGG | G,G 1150 | XP_011526446.1 | |
XM_011528146.2 | 3553 | Silent Mutation | GGA,GGG | G,G 1115 | XP_011526448.1 | |
XM_017027028.1 | 3553 | Silent Mutation | GGA,GGG | G,G 1141 | XP_016882517.1 | |
XM_017027029.1 | 3553 | Silent Mutation | GGA,GGG | G,G 1150 | XP_016882518.1 | |
XM_017027030.1 | 3553 | Intron | XP_016882519.1 |