Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATTGCAAACTCTTGGTCCTGCCAAC[A/C]CAGCCGATTGTGCCAAGGTTCTCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611468 MIM: 612332 | ||||||||||||||||||||
Literature Links: |
BDNF-AS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BDNF-AS - BDNF antisense RNA | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LIN7C - lin-7 homolog C, crumbs cell polarity complex component | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR8087 - microRNA 8087 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |