Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCTCAGGCACCTCTGGGTACAGTC[A/G]GACGTCTTGGCCCCGCCTATCTCGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610051 MIM: 603171 MIM: 610711 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CHMP4A PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CHMP4A - charged multivesicular body protein 4A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MDP1 - magnesium dependent phosphatase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199821.1 | 251 | Nonsense Mutation | CGA,TGA | R,* 46 | NP_001186750.1 | |
NM_001199822.1 | 251 | Nonsense Mutation | CGA,TGA | R,* 46 | NP_001186751.1 | |
NM_138476.3 | 251 | Nonsense Mutation | CGA,TGA | R,* 46 | NP_612485.2 |
NEDD8 - neural precursor cell expressed, developmentally down-regulated 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NEDD8-MDP1 - NEDD8-MDP1 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TSSK4 - testis specific serine kinase 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |