Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGCAACCCAGAAAACAGACACAGG[A/C]CTGACTCAAGGACTCCTGAAAGTTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 613297 MIM: 611756 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MARCH6 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MARCH6 - membrane associated ring-CH-type finger 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ROPN1L - rhophilin associated tail protein 1 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001201466.1 | 401 | Silent Mutation | GGA,GGC | G,G 73 | NP_001188395.1 | |
NM_031916.4 | 401 | Silent Mutation | GGA,GGC | G,G 73 | NP_114122.2 | |
XM_006714503.2 | 401 | Silent Mutation | GGA,GGC | G,G 73 | XP_006714566.1 | |
XM_006714504.2 | 401 | Silent Mutation | GGA,GGC | G,G 73 | XP_006714567.1 | |
XM_017009946.1 | 401 | Silent Mutation | GGA,GGC | G,G 73 | XP_016865435.1 | |
XM_017009947.1 | 401 | Silent Mutation | GGA,GGC | G,G 73 | XP_016865436.1 |
ROPN1L-AS1 - ROPN1L antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |