Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCAGACTTGTAGTTTGATCTTCTT[C/T]CCCTCTATATCCACAGTGCGGATCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604671 MIM: 602672 MIM: 603702 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
JTB PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
JTB - jumping translocation breakpoint | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NUP210L - nucleoporin 210 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB13 - RAB13, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001272038.1 | 421 | UTR 5 | NP_001258967.1 | |||
NM_002870.3 | 421 | Silent Mutation | GGA,GGG | G,G 54 | NP_002861.1 | |
XM_017001959.1 | 421 | Intron | XP_016857448.1 |
RPS27 - ribosomal protein S27 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |