Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGCCCAGTCCTGTGGTGCTAAGCA[C/G]TGTGCCAACTGAGGCCTTCCTGGCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
16 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602913 MIM: 603673 MIM: 611713 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BTBD19 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BTBD19 - BTB domain containing 19 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136537.1 | 566 | Missense Mutation | ACT,AGT | T,S 76 | NP_001130009.1 | |
XM_006710386.3 | 566 | Missense Mutation | ACT,AGT | T,S 76 | XP_006710449.1 | |
XM_011540803.2 | 566 | Missense Mutation | ACT,AGT | T,S 76 | XP_011539105.1 | |
XM_011540805.2 | 566 | Missense Mutation | ACT,AGT | T,S 76 | XP_011539107.1 | |
XM_017000447.1 | 566 | Missense Mutation | ACT,AGT | T,S 76 | XP_016855936.1 | |
XM_017000448.1 | 566 | Missense Mutation | ACT,AGT | T,S 76 | XP_016855937.1 | |
XM_017000449.1 | 566 | Missense Mutation | ACT,AGT | T,S 76 | XP_016855938.1 |
PLK3 - polo like kinase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTCH2 - patched 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TCTEX1D4 - Tctex1 domain containing 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001013632.3 | 566 | Intron | NP_001013654.1 |