Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCGCTCGTGGATCGATACTTCACTC[G/T]CTGGTACAAACCGGGTAAGTGCGGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604785 MIM: 603722 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CTNNAL1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CTNNAL1 - catenin alpha like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM206A - family with sequence similarity 206 member A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017832.3 | 155 | Missense Mutation | CGC,CTC | R,L 22 | NP_060302.1 | |
XM_011518816.2 | 155 | Missense Mutation | CGC,CTC | R,L 22 | XP_011517118.1 |
IKBKAP - inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318360.1 | 155 | Intron | NP_001305289.1 | |||
NM_003640.4 | 155 | Intron | NP_003631.2 | |||
XM_011519136.1 | 155 | Intron | XP_011517438.1 | |||
XM_011519137.1 | 155 | Intron | XP_011517439.1 | |||
XM_017015238.1 | 155 | Intron | XP_016870727.1 |