Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGTGTGGTTGCGCATACCCGTAAT[C/T]CCAGCTACTCCAGGAGCTGAGGCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616844 MIM: 613256 | ||||||||||||||||||||
Literature Links: |
DNAJC17 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DNAJC17 - DnaJ heat shock protein family (Hsp40) member C17 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPP1R14D - protein phosphatase 1 regulatory inhibitor subunit 14D | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001130143.1 | 432 | Missense Mutation | AAT,GAT | N,D 122 | NP_001123615.1 | |
NM_017726.7 | 432 | Intron | NP_060196.1 | |||
XM_017022372.1 | 432 | Intron | XP_016877861.1 |
ZFYVE19 - zinc finger FYVE-type containing 19 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |