Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGATGGCGGCGGAGAAGGAGCCGTT[C/T]CTGGTGCCGGCCCCGCCGCCGCCGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611478 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MEPCE PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MEPCE - methylphosphate capping enzyme | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001194990.1 | 421 | Intron | NP_001181919.1 | |||
NM_001194991.1 | 421 | Intron | NP_001181920.1 | |||
NM_001194992.1 | 421 | Intron | NP_001181921.1 | |||
NM_019606.5 | 421 | Silent Mutation | TTC,TTT | F,F 11 | NP_062552.2 | |
XM_011516410.2 | 421 | Intron | XP_011514712.1 |
PPP1R35 - protein phosphatase 1 regulatory subunit 35 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZCWPW1 - zinc finger CW-type and PWWP domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001258008.1 | 421 | Intron | NP_001244937.1 | |||
NM_017984.4 | 421 | Intron | NP_060454.3 | |||
XM_005250479.2 | 421 | Intron | XP_005250536.1 | |||
XM_005250480.2 | 421 | Intron | XP_005250537.1 | |||
XM_006716035.3 | 421 | Intron | XP_006716098.1 | |||
XM_006716036.2 | 421 | Intron | XP_006716099.1 | |||
XM_006716037.3 | 421 | Intron | XP_006716100.1 | |||
XM_006716038.3 | 421 | Intron | XP_006716101.1 | |||
XM_006716040.3 | 421 | Intron | XP_006716103.1 | |||
XM_017012379.1 | 421 | Intron | XP_016867868.1 | |||
XM_017012380.1 | 421 | Intron | XP_016867869.1 |