Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGCTGGGAGGGCCGGTCCTAAGA[A/G]TAACACATGTGCACCTCACTCACGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||
Literature Links: |
CXorf40B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CXorf40B - chromosome X open reading frame 40B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001013845.1 | Intron | NP_001013867.1 | ||||
XM_005274698.1 | Intron | XP_005274755.1 | ||||
XM_005274699.1 | Intron | XP_005274756.1 | ||||
XM_005274700.1 | Intron | XP_005274757.1 | ||||
XM_005274701.2 | Intron | XP_005274758.1 | ||||
XM_005274702.3 | Intron | XP_005274759.1 | ||||
XM_006724826.3 | Intron | XP_006724889.1 | ||||
XM_011531180.2 | Intron | XP_011529482.1 | ||||
XM_011531181.2 | Intron | XP_011529483.1 | ||||
XM_017029585.1 | Intron | XP_016885074.1 | ||||
XM_017029586.1 | Intron | XP_016885075.1 | ||||
XM_017029587.1 | Intron | XP_016885076.1 | ||||
XM_017029588.1 | Intron | XP_016885077.1 | ||||
XM_017029589.1 | Intron | XP_016885078.1 | ||||
XM_017029590.1 | Intron | XP_016885079.1 | ||||
XM_017029591.1 | Intron | XP_016885080.1 | ||||
XM_017029592.1 | Intron | XP_016885081.1 | ||||
XM_017029593.1 | Intron | XP_016885082.1 |
LINC00894 - long intergenic non-protein coding RNA 894 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927685 - heat shock transcription factor, X-linked-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |