Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGAGGCATAACTGCTTTGCCTCC[A/C]GTCATCATCTGGGGGCATATCTACT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 114106 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
PPP3CB PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
PPP3CB - protein phosphatase 3 catalytic subunit beta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPP3CB-AS1 - PPP3CB antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USP54 - ubiquitin specific peptidase 54 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320437.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1580 | NP_001307366.1 | |
NM_001320441.1 | 4828 | Intron | NP_001307370.1 | |||
NM_152586.3 | 4828 | Missense Mutation | GGG,TGG | G,W 1642 | NP_689799.3 | |
XM_005269582.2 | 4828 | Missense Mutation | GGG,TGG | G,W 1538 | XP_005269639.1 | |
XM_011539368.2 | 4828 | Missense Mutation | GGG,TGG | G,W 1607 | XP_011537670.1 | |
XM_017015759.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1666 | XP_016871248.1 | |
XM_017015760.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1666 | XP_016871249.1 | |
XM_017015761.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1666 | XP_016871250.1 | |
XM_017015762.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1666 | XP_016871251.1 | |
XM_017015763.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1666 | XP_016871252.1 | |
XM_017015764.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1666 | XP_016871253.1 | |
XM_017015765.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1666 | XP_016871254.1 | |
XM_017015766.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1666 | XP_016871255.1 | |
XM_017015767.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1666 | XP_016871256.1 | |
XM_017015768.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1666 | XP_016871257.1 | |
XM_017015769.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1666 | XP_016871258.1 | |
XM_017015770.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1666 | XP_016871259.1 | |
XM_017015771.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1664 | XP_016871260.1 | |
XM_017015772.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1661 | XP_016871261.1 | |
XM_017015773.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1644 | XP_016871262.1 | |
XM_017015774.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1642 | XP_016871263.1 | |
XM_017015775.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1642 | XP_016871264.1 | |
XM_017015776.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1642 | XP_016871265.1 | |
XM_017015777.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1642 | XP_016871266.1 | |
XM_017015778.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1626 | XP_016871267.1 | |
XM_017015779.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1619 | XP_016871268.1 | |
XM_017015780.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1614 | XP_016871269.1 | |
XM_017015781.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1609 | XP_016871270.1 | |
XM_017015782.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1602 | XP_016871271.1 | |
XM_017015783.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1585 | XP_016871272.1 | |
XM_017015784.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1585 | XP_016871273.1 | |
XM_017015785.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1579 | XP_016871274.1 | |
XM_017015786.1 | 4828 | Missense Mutation | GGG,TGG | G,W 1545 | XP_016871275.1 |