Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGGGAAGTTGGCAATCAGTTCCTC[A/G]TCATCCTTGTTGAGCGCCACAAAGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612234 MIM: 612235 MIM: 612333 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CALHM1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CALHM1 - calcium homeostasis modulator 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CALHM2 - calcium homeostasis modulator 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015916.4 | 1391 | Silent Mutation | GAC,GAT | D,D 260 | NP_057000.2 | |
XM_006717880.2 | 1391 | Silent Mutation | GAC,GAT | D,D 260 | XP_006717943.1 | |
XM_006717883.2 | 1391 | Silent Mutation | GAC,GAT | D,D 260 | XP_006717946.1 | |
XM_006717884.3 | 1391 | UTR 3 | XP_006717947.1 | |||
XM_011539848.2 | 1391 | Silent Mutation | GAC,GAT | D,D 260 | XP_011538150.1 | |
XM_017016306.1 | 1391 | Silent Mutation | GAC,GAT | D,D 260 | XP_016871795.1 | |
XM_017016307.1 | 1391 | Silent Mutation | GAC,GAT | D,D 260 | XP_016871796.1 | |
XM_017016308.1 | 1391 | UTR 3 | XP_016871797.1 | |||
XM_017016309.1 | 1391 | UTR 3 | XP_016871798.1 |
PDCD11 - programmed cell death 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |