Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGAAGCTGTGGGCCTGGACTGGGG[C/G]TAGCAGCAGAGGGGCGGCCAGGTAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
C10orf95 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C10orf95 - chromosome 10 open reading frame 95 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024886.2 | 309 | Nonsense Mutation | TAC,TAG | Y,* 78 | NP_079162.1 |
MFSD13A - major facilitator superfamily domain containing 13A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPARP-AS1 - RPARP antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |