Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCCTCTTCTCTTTTATAGGGAAC[C/T]TCTGTGGGGGAAAACGAGAAACCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609768 MIM: 604532 | ||||||||||||||||||||
Literature Links: |
BLOC1S2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BLOC1S2 - biogenesis of lysosomal organelles complex 1 subunit 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PKD2L1 - polycystin 2 like 1, transient receptor potential cation channel | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001253837.1 | 2886 | Silent Mutation | GAA,GAG | E,E 732 | NP_001240766.1 | |
NM_016112.2 | 2886 | Silent Mutation | GAA,GAG | E,E 779 | NP_057196.2 | |
XM_011540323.2 | 2886 | UTR 3 | XP_011538625.1 | |||
XM_011540325.2 | 2886 | UTR 3 | XP_011538627.1 | |||
XM_017016875.1 | 2886 | UTR 3 | XP_016872364.1 | |||
XM_017016876.1 | 2886 | UTR 3 | XP_016872365.1 |