Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AATACCTTGCGGGCCCCCCGTGTCC[G/T]CACAGCCTTCACCATGGAGCAGGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604130 MIM: 607158 | ||||||||||||||||||||
Literature Links: |
MIR202 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR202 - microRNA 202 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR202HG - MIR202 host gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UTF1 - undifferentiated embryonic cell transcription factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VENTX - VENT homeobox | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014468.3 | 290 | Intron | NP_055283.1 | |||
XM_017016073.1 | 290 | Missense Mutation | CGC,CTC | R,L 26 | XP_016871562.1 |