Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGCGTATGGCCGTCCGCTCCAGGC[A/G]CAGTCTGGAGGTGTCCGGGGGGATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616103 MIM: 600342 | ||||||||||||||||||||
Literature Links: |
LRIT1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LRIT1 - leucine rich repeat, Ig-like and transmembrane domains 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015613.2 | 471 | Missense Mutation | CGC,TGC | R,C 65 | NP_056428.1 | |
XM_011539623.2 | 471 | Missense Mutation | CGC,TGC | R,C 16 | XP_011537925.1 | |
XM_011539626.2 | 471 | Intron | XP_011537928.1 |
RGR - retinal G protein coupled receptor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |