Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCCAAGAGGCAAGATGGAGGGCTC[C/T]TTAAGGGGCCACCGTATCCCGGCTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602228 MIM: 614316 | ||||||||||||||||||||
Literature Links: |
TCF7L2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
TCF7L2 - transcription factor 7 like 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001146274.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | NP_001139746.1 | |
NM_001146283.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | NP_001139755.1 | |
NM_001146284.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | NP_001139756.1 | |
NM_001146285.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | NP_001139757.1 | |
NM_001146286.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | NP_001139758.1 | |
NM_001198525.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | NP_001185454.1 | |
NM_001198526.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | NP_001185455.1 | |
NM_001198527.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | NP_001185456.1 | |
NM_001198528.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | NP_001185457.1 | |
NM_001198529.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | NP_001185458.1 | |
NM_001198530.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | NP_001185459.1 | |
NM_001198531.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | NP_001185460.1 | |
NM_030756.4 | 821 | Missense Mutation | CTT,TTT | L,F 95 | NP_110383.2 | |
XM_005270071.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270128.1 | |
XM_005270075.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270132.1 | |
XM_005270077.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270134.1 | |
XM_005270078.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270135.1 | |
XM_005270079.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270136.1 | |
XM_005270080.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270137.1 | |
XM_005270084.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270141.1 | |
XM_005270085.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270142.1 | |
XM_005270086.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270143.1 | |
XM_005270088.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270145.1 | |
XM_005270089.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270146.1 | |
XM_005270091.2 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270148.1 | |
XM_005270092.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270149.1 | |
XM_005270093.2 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270150.1 | |
XM_005270094.2 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270151.1 | |
XM_005270095.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270152.1 | |
XM_005270096.2 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270153.1 | |
XM_005270100.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270157.1 | |
XM_005270101.2 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270158.1 | |
XM_005270102.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270159.1 | |
XM_005270103.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270160.1 | |
XM_005270104.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_005270161.1 | |
XM_011540109.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_011538411.1 | |
XM_011540110.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_011538412.1 | |
XM_011540111.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_011538413.1 | |
XM_011540113.2 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_011538415.1 | |
XM_011540116.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_011538418.1 | |
XM_017016584.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_016872073.1 | |
XM_017016585.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_016872074.1 | |
XM_017016586.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_016872075.1 | |
XM_017016587.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_016872076.1 | |
XM_017016588.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_016872077.1 | |
XM_017016589.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_016872078.1 | |
XM_017016590.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_016872079.1 | |
XM_017016591.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_016872080.1 | |
XM_017016592.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_016872081.1 | |
XM_017016593.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_016872082.1 | |
XM_017016594.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_016872083.1 | |
XM_017016595.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_016872084.1 | |
XM_017016596.1 | 821 | Missense Mutation | CTT,TTT | L,F 95 | XP_016872085.1 |
VTI1A - vesicle transport through interaction with t-SNAREs 1A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |