Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAGCAGGAGCAATGTGAGGTTTCT[C/G]TCATGTATGGGCCCAAGGACTTTAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 191350 MIM: 601772 MIM: 609806 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C2CD2L PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C2CD2L - C2CD2 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DPAGT1 - dolichyl-phosphate N-acetylglucosaminephosphotransferase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001382.3 | 1766 | Missense Mutation | GAC,GAG | D,E 376 | NP_001373.2 | |
XM_005271422.2 | 1766 | Missense Mutation | GAC,GAG | D,E 376 | XP_005271479.1 | |
XM_011542648.1 | 1766 | Missense Mutation | GAC,GAG | D,E 269 | XP_011540950.1 | |
XM_017017293.1 | 1766 | Missense Mutation | GAC,GAG | D,E 269 | XP_016872782.1 | |
XM_017017294.1 | 1766 | UTR 3 | XP_016872783.1 | |||
XM_017017295.1 | 1766 | Missense Mutation | GAC,GAG | D,E 204 | XP_016872784.1 |
H2AFX - H2A histone family member X | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HMBS - hydroxymethylbilane synthase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |