Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTGCAGTGCCATGTGGGCCATGCC[C/T]GCCGGGAAGCCCTGGCCCGCTTCGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602640 MIM: 605964 | ||||||||||||||||||||
Literature Links: |
ARL2-SNX15 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARL2-SNX15 - ARL2-SNX15 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NAALADL1 - N-acetylated alpha-linked acidic dipeptidase-like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005468.2 | 1149 | Intron | NP_005459.2 | |||
XM_011544706.2 | 1149 | Intron | XP_011543008.1 | |||
XM_011544707.2 | 1149 | Intron | XP_011543009.1 | |||
XM_011544708.2 | 1149 | Intron | XP_011543010.1 | |||
XM_011544709.2 | 1149 | Intron | XP_011543011.1 | |||
XM_011544710.2 | 1149 | Intron | XP_011543012.1 | |||
XM_011544711.2 | 1149 | Intron | XP_011543013.1 | |||
XM_011544712.2 | 1149 | Intron | XP_011543014.1 |
SAC3D1 - SAC3 domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013299.3 | 1149 | Missense Mutation | CGC,TGC | R,C 254 | NP_037431.3 |
SNX15 - sorting nexin 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |