Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCAGGGAGATACTGCACCGGGGCG[G/T]CCTCAATGTGGTCTCCAGTGGCCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608752 MIM: 606227 MIM: 606130 | ||||||||||||||||||||
Literature Links: |
C1QTNF5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C1QTNF5 - C1q and tumor necrosis factor related protein 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MFRP - membrane frizzled-related protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF26 - ring finger protein 26 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032015.4 | 979 | Missense Mutation | GGC,GTC | G,V 119 | NP_114404.1 |