Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGGTTGAGTAGAGTCTTCAGCAAA[G/T]CTGGGAAGTTGGGTGTTCCCCAGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603057 MIM: 602366 MIM: 600475 MIM: 607998 | ||||||||||||||||||||
Literature Links: |
DCHS1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DCHS1 - dachsous cadherin-related 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ILK - integrin linked kinase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAF10 - TATA-box binding protein associated factor 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TPP1 - tripeptidyl peptidase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000391.3 | 1725 | Missense Mutation | GAT,GCT | D,A 555 | NP_000382.3 |