Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCTGCCTGCCTACCTGGCAGTGCC[A/G]ATGTTCCGATACTGGCACAGCAGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 118495 MIM: 601441 MIM: 162096 | ||||||||||||||||||||
Literature Links: |
CHRM4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CHRM4 - cholinergic receptor muscarinic 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000741.3 | 1476 | Silent Mutation | NP_000732.2 |
DGKZ - diacylglycerol kinase zeta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MDK - midkine (neurite growth-promoting factor 2) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4688 - microRNA 4688 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |