Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCCTACAACAACCGTGCCCAGGCC[C/G]GGCGACTCCAGGGAGACGTGGCAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 159555 MIM: 613934 | ||||||||||||||||||||
Literature Links: |
KMT2A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KMT2A - lysine methyltransferase 2A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101929089 - uncharacterized LOC101929089 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM25 - transmembrane protein 25 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTC36 - tetratricopeptide repeat domain 36 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |