Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAGTCCGGATCAGTTGCCCCTGGC[C/T]TGTTCCCCCGATGATTGAAGGCACT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605360 MIM: 602364 MIM: 608296 MIM: 136515 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CCDC85B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CCDC85B - coiled-coil domain containing 85B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006848.2 | 971 | Silent Mutation | GCC,GCT | A,A 197 | NP_006839.2 |
CTSW - cathepsin W | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FIBP - FGF1 intracellular binding protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FOSL1 - FOS like 1, AP-1 transcription factor subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001300844.1 | 971 | Intron | NP_001287773.1 | |||
NM_001300855.1 | 971 | Intron | NP_001287784.1 | |||
NM_001300856.1 | 971 | Intron | NP_001287785.1 | |||
NM_001300857.1 | 971 | Intron | NP_001287786.1 | |||
NM_005438.4 | 971 | Intron | NP_005429.1 |